version
PlantPromoterDB promoter information of AK100188

Summary of Gene (AK100188)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0176100        NCBI 
Gene model AK100188  
Description Similar to RSW1-like cellulose synthase catalytic subunit (Fragment).  
#
#

Overview

Focused view (chromosome 5: 4551555-4550356)

Genome position     
from initiation codon
AF030052            
AK067850            
AK067967            
AK098978            
AK099228            
AK099281            
AK102140            
J013000D01          
J013001L01          
J013021H24          
J013021O22          
J013022I11          
J013024E24          
J013026J02          
J013027G12          
J013029H11          
J013030N24          
J013031L14          
J013031M07          
J013033H23          
J013033M05          
J013034C17          
J013034D18          
J013034K16          
J013036L17          
J013036L20          
J013039C16          
J013039O09          
J013047H14          
J013048I05          
J013049L16          
J013050D12          
J013051J04          
J013052D19          
J013060B03          
J013060B16          
J013070N07          
J013071L12          
J013071M15          
J013088P12          
J013091C12          
J013094A18          
J013096O14          
J013102A22          
J013106E06          
J013109D06          
J013112H16          
J013121N01          
J013123A09          
J013130O12          
J013132C19          
J013132E13          
J013135E24          
J013135F16          
J013169P10          
J023002D05          
J023004H11          
J023007E12          
J023010C05          
J023020J03          
J023023F09          
J023034D20          
J023034M05          
J023036C09          
J023036F02          
J023044B14          
J023048H10          
J023050D13          
J023052F12          
J023056L02          
J023058M06          
J023073G08          
J023075I15          
J023078B02          
J023084N22          
J023090A20          
J023093I08          
J023109C24          
J023122O10          
J023123I21          
J023133H17          
J023140B06          
J023141B18          
J023141H16          
J023145M07          
J033024G13          
J033025K09          
J033027H22          
J033029I01          
J033030G11          
J033038E08          
J033042C01          
J033042E21          
J033058E16          
J033072B14          
J033073J16          
J033079D12          
J033082N09          
J033089I23          
J033091E09          
J033091P03          
J033103M10          
J033106A12          
J033106C10          
J033111G17          
J033116N06          
J033120C11          
J033124C17          
J033124O12          
J033133G14          
J033138A10          
J033138I11          
J033150N18          
J043001A04          
J043003F09          
J043039O05          
J065019K19          
J065031C04          
J065033I17          
J065040M03          
J065054E22          
J065112F24          
J065165I21          
J080001O13          
J080005G22          
J080006K02          
J080011L06          
J080011P19          
J080013A04          
J080013L09          
J080014J16          
J080014M01          
J080014M06          
J080015P07          
J080021P10          
J080022H01          
J080023P11          
J080028F01          
J080030K10          
J080030O10          
J080032C11          
J080032G15          
J080033P21          
J080033P22          
J080034M04          
J080035H23          
J080036L21          
J080037D18          
J080039C03          
J080039I22          
J080040O07          
J080042M12          
J080044I18          
J080044I21          
J080044J24          
J080044M17          
J080047P16          
J080053G20          
J080055O10          
J080059B01          
J080060E12          
J080060O13          
J080062E22          
J080063K08          
J080064A06          
J080066G19          
J080066I19          
J080067E19          
J080067K14          
J080067K15          
J080068H13          
J080068J09          
J080070C14          
J080072C03          
J080074I15          
J080075A17          
J080080A10          
J080082P07          
J080083F01          
J080086L15          
J080092L15          
J080093A18          
J080095B13          
J080096N08          
J080097E02          
J080097G09          
J090001K08          
J090001L09          
J090003P09          
J090012C16          
J090016J23          
J090023A16          
J090029O10          
J090030P06          
J090037F09          
J090045M04          
J090047M05          
J090049H09          
J090051H04          
J090052F08          
J090058B22          
J090064E23          
J090070A21          
J090070I10          
J090078I01          
J090085D24          
J090086K19          
J090087O19          
J090093F18          
J090095O03          
J090098J02          
J100021J03          
J100035M14          
J100039J07          
J100042K07          
J100045E13          
TSS from cDNA
TSS information
AK100188                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100188

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-4550743-188
TSS clone peakAclone-4550740-185

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCACCAAC-45508084550815-253-260
 OsREG520CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGATCCGACGG-45508614550869-306-314
 OsREG483ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGATCCGACGGCCGAGAT-45508864550901-331-346
 OsREG483ATCCGACG         PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG        PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG635       GGCCGAGA  PPDB Motif  PLACE Motif 
 OsREG485        GCCGAGAT PPDB Motif  PLACE Motif 
REGCCCGGGCCCACCC-45509404550952-385-397
 OsREG539CCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600     GCCCACCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.