version
PlantPromoterDB promoter information of AK100216

Summary of Gene (AK100216)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0170000        NCBI 
Gene model AK100216  
Description Protein of unknown function DUF266, plant family protein.  
#
#

Overview

Focused view (chromosome 5: 4180691-4179492)

Genome position     
from initiation codon
003-129-C04         
AK103412            
J023045H21          
J033128G01          
J065017O10          
J065032H11          
J065120G09          
TSS from cDNA
TSS information
AK100216                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100216

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-4179835-144
TSS clone peakGclone-4179746-55

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCTCTC-41797474179758-56-67
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACGCG-41798054179812-114-121
 OsREG530CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGCCGAGCCGTTG-41799504179960-259-269
 OsREG540CCGAGCCG    PPDB Motif  PLACE Motif 
 OsREG469   AGCCGTTG PPDB MotifCCAACGG  PLACE Motif 
REGCCACCTGT-41799754179982-284-291
 OsREG436CCACCTGT PPDB Motif  PLACE Motif 
REGCCGATCCGACGGCCCAGA-41799854180002-294-311
 OsREG541CCGATCCG           PPDB Motif  PLACE Motif 
 OsREG588  GATCCGAC         PPDB MotifCCGAC  PLACE Motif 
 OsREG483   ATCCGACG        PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546    TCCGACGG       PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG584       GACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445        ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565         CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629          GGCCCAGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.