version
PlantPromoterDB promoter information of AK100231

Summary of Gene (AK100231)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0137500        NCBI 
Gene model AK100231  
Description Similar to VDAC3.1.  
#
#

Overview

Focused view (chromosome 3: 2047230-2048429)

Genome position     
from initiation codon
006-040-G01         
015-054-G04         
AK060148            
AK073584            
AK107864            
J013146L24          
J023022O09          
J023049J19          
J023133L05          
J023143P12          
J033040B12          
J033050O14          
J033066G05          
J033090F19          
J065007J18          
J100067H13          
TSS from cDNA
TSS information
AK100231                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100231

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+2047824-406
TSS clone peakCclone+2047839-391
TSS cloneCclone+2047847-383

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCTCTCTCTC+20478132047828-417-402
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGGCCGTA+20477132047723-517-507
 OsREG616GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544 CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG446  CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG645   GGGCCGTA PPDB MotifGCCCA  PLACE Motif 
REGGAAGCCCATAT+20477612047771-469-459
 OsREG582GAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480   GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCACGT+20477782047788-452-442
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG463  AGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449   GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.