version
PlantPromoterDB promoter information of AK100241

Summary of Gene (AK100241)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0835500        NCBI 
Gene model AK100241  
Description Similar to Respiratory burst oxidase protein.  
#
#

Overview

Focused view (chromosome 1: 37568145-37569344)

Genome position     
from initiation codon
J013095I15          
J023054P13          
J033125N13          
J090014H21          
J090039K08          
J100078C13          
TSS from cDNA
TSS information
AK100241                         5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100241

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+37568996-149

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGGCTATAA+3756895937568967-186-178
Y PatchCTCCCTCTCCCCTTCTC+3756900737569023-138-122
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGGGCCCACT+3756872137568731-424-414
 OsREG619GCGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG566 CGGGCCCA   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640  GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478   GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGGCCCCACC+3756876337568770-382-375
 OsREG612GCCCCACC PPDB Motif  PLACE Motif 
REGAGCCGTCCG+3756878837568796-357-349
 OsREG468AGCCGTCC  PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG PPDB Motif  PLACE Motif 
REGGTCCCACCAC+3756881037568819-335-326
 OsREG651GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG527  CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGGCCCACGTGTCC+3756882237568833-323-312
 OsREG449GCCCACGT     PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508 CCCACGTG    PPDB MotifACGT  PLACE Motif 
 OsREG434  CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509   CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451    ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGATCCGACGG+3756889737568905-248-240
 OsREG483ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCCCCCGCG+3756891637568923-229-222
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.