version
PlantPromoterDB promoter information of AK100403

Summary of Gene (AK100403)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0897200        NCBI 
Gene model AK100403  
Description Similar to Ribonuclease 2 precursor (EC 3.1.27.1).  
#
#

Overview

Focused view (chromosome 1: 40750577-40749378)

Genome position     
from initiation codon
006-026-H09         
006-029-B03         
006-038-C04         
006-047-G03         
006-112-F02         
AK061032            
AK061505            
AK065055            
AK105061            
AK106167            
AK121862            
J013001J04          
J033103A19          
J065166D04          
J065195J12          
J075005P18          
J075069K20          
J075191B15          
J090027D12          
J090032M01          
J090079K10          
J100018O17          
J100080H14          
J100088D08          
TSS from cDNA
TSS information
AK100403                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100403

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-40749650-73
TSS clone peakGclone-40749648-71

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCCCCACCTGTCAGTG-4074971040749727-133-150
 OsREG641GGGCCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG631 GGCCCCAC          PPDB Motif  PLACE Motif 
 OsREG612  GCCCCACC         PPDB Motif  PLACE Motif 
 OsREG514    CCCACCTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG436     CCACCTGT      PPDB Motif  PLACE Motif 
 OsREG501      CACCTGTC     PPDB Motif  PLACE Motif 
 OsREG551        CCTGTCAG   PPDB Motif  PLACE MotifTGAC 
 OsREG453         CTGTCAGT  PPDB Motif  PLACE MotifTGAC 
 OsREG510          TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGGAAGCCCAC-4074985540749863-278-286
 OsREG582GAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.