version
PlantPromoterDB promoter information of AK100407

Summary of Gene (AK100407)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0213600        NCBI 
Gene model AK100407  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 3: 5972842-5974041)

Genome position     
from initiation codon
J043026C02          
TSS from cDNA
TSS information
AK100407                         5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100407

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+5973716-126

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCTC+59737235973730-119-112
Y PatchTCCTTCCT+59737375973744-105-98
Y PatchTCCCTCTCTCTCT+59737485973760-94-82
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTCGGATC+59734295973438-413-404
 OsREG546CCGTCGGA   PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483 CGTCGGAT  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588  GTCGGATC PPDB MotifCCGAC  PLACE Motif 
REGAAACGGCCCG+59734485973457-394-385
 OsREG420AAACGGCC   PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG423 AACGGCCC  PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG446  ACGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGTGTGGGGCCCACC+59735065973518-336-324
 OsREG611TGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC PPDB MotifGCCCA  PLACE Motif 
REGACGTGGGGCCC+59735325973542-310-300
 OsREG450ACGTGGGG    PPDB MotifACGT  PLACE Motif 
 OsREG572 CGTGGGGC   PPDB Motif  PLACE Motif 
 OsREG631  GTGGGGCC  PPDB Motif  PLACE Motif 
 OsREG641   TGGGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGCCCATCG+59735675973574-275-268
 OsREG553GCCCATCG PPDB MotifGCCCA  PLACE Motif 
REGGGTCCCACACG+59736095973619-233-223
 OsREG650GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG526   CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGACCCACCCG+59736215973635-221-207
 OsREG651GGTGGGAC        PPDB MotifGGGACCC  PLACE Motif 
 OsREG650 GTGGGACC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  TGGGACCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG637   GGGACCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG622    GGACCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG528       CCCACCCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.