version
PlantPromoterDB promoter information of AK100570

Summary of Gene (AK100570)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0135700        NCBI 
Gene model AK100570  
Description DNA polymerase V family protein.  
#
#

Overview

Focused view (chromosome 2: 1881044-1882243)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK100570                         5'->3' (+)
Promoter sequence

 
AK069843            
J023034H09          
J033090D08          
J100025N07          
J100075G18          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100570

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+1882715-129

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGACTATA+18826741882681-170-163
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGCTCGG+18824451882452-399-392
 OsREG540CGGCTCGG PPDB Motif  PLACE Motif 
REGGGTGGGCCCCAG+18825111882522-333-322
 OsREG628GGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG580    GGCCCCAG PPDB Motif  PLACE Motif 
REGCCCCCACGTGTC+18825351882546-309-298
 OsREG536CCCCCACG     PPDB Motif  PLACE Motif 
 OsREG450 CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG508  CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG434   CCACGTGT  PPDB MotifACGT  PLACE Motif 
 OsREG509    CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCCCACGTGTC+18825571882567-287-277
 OsREG450CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG508 CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG434  CCACGTGT  PPDB MotifACGT  PLACE Motif 
 OsREG509   CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTGTGGGCCTAACTGGGCCGGC+18825941882614-250-230
 OsREG627TGTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG472 GTGGGCCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA            PPDB MotifGCCCA  PLACE Motif 
 OsREG425         AACTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG454          ACTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565           CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542            TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG615             GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCTGAATTGGGCCGCA+18826201882641-224-203
 OsREG437ACATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT              PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG491  ATGGGCTG             PPDB MotifGCCCA  PLACE Motif 
 OsREG657   TGGGCTGA            PPDB MotifGCCCA  PLACE Motif 
 OsREG433          AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG492           ATTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563            TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618             TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643              GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCTC+18826561882665-188-179
 OsREG581CTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587  TGGGCCTC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.