version
PlantPromoterDB promoter information of AK100584

Summary of Gene (AK100584)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0681100        NCBI 
Gene model AK100584  
Description Protein of unknown function DUF604 family protein.  
#
#

Overview

Focused view (chromosome 2: 28693267-28692068)

Genome position     
from initiation codon
J023106A15          
TSS from cDNA
TSS information
AK100584                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100584

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-28692492-225

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTCCACG-2869257128692578-304-311
 OsREG570GGTCCACG PPDB Motif  PLACE Motif 
REGGAAGCCCACGAA-2869259328692604-326-337
 OsREG582GAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG463  AGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG601   GCCCACGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG529    CCCACGAA PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCATGA-2869261528692625-348-358
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG467  AGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609   GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGGCCCAGTT-2869263628692643-369-376
 OsREG425GCCCAGTT PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATCT-2869264728692655-380-388
 OsREG466AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456 GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCAT-2869265728692667-390-400
 OsREG593GTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487   TGGGCCAT PPDB MotifGCCCA  PLACE Motif 
REGGCTGGGCT-2869269128692698-424-431
 OsREG464GCTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGTCCGTCCG-2869275828692766-491-499
 OsREG623GTCCGTCC  PPDB Motif  PLACE Motif 
 OsREG561 TCCGTCCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.