version
PlantPromoterDB promoter information of AK100613

Summary of Gene (AK100613)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0104600        NCBI 
Gene model AK100613  
Description Similar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green).  
#
#

Overview

Focused view (chromosome 1: 256441-255242)

Genome position     
from initiation codon
AK058683            
J023107M18          
J075149N19          
J075195M06          
J090023K19          
J090042G02          
TSS from cDNA
TSS information
AK100613                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100613

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-255872-431
TSS clone peakAclone-255571-130

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCTCTCCTC-255522255534-81-93
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGAGCCG-255612255619-171-178
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 
REGCCGAGCCG-255653255660-212-219
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 
REGGCCCATCC-255695255702-254-261
 OsREG608GCCCATCC PPDB MotifGCCCA  PLACE Motif 
REGCTCGGCCC-255719255726-278-285
 OsREG575CTCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCGCA-255758255768-317-327
 OsREG497CAAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG632   GGCCCGCA PPDB Motif  PLACE Motif 
REGCCCACACG-255829255836-388-395
 OsREG526CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCCATTAGTGGCCCAATA-255928255950-487-509
 OsREG419AAAAGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT              PPDB MotifGCCCA  PLACE Motif 
 OsREG432   AGCCCATT             PPDB MotifGCCCA  PLACE Motif 
 OsREG610    GCCCATTA            PPDB MotifGCCCA  PLACE Motif 
 OsREG653            GTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659             TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492              GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596               GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGCCGAGCCG-255965255972-524-531
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 
REGAGCTGAGC-256052256059-611-618
 OsREG470AGCTGAGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.