PlantPromoterDB promoter information of AK100656
Summary of Gene (AK100656)
|
Overview
|
Focused view (chromosome 3: 1775314-1774115)
|
Genome position
from initiation codon J013157D14 J023086B04 J033115L20 J033140O12 J033149J11 J065112C14 J065195L18 J090070D10 TSS from cDNA TSS information AK100656 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence |
|
|
|
Promoter Summary of AK100656
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | A | clone | - | 1774717 | -153 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TTCTCCTCCCTC | - | 1774720 | 1774731 | -156 | -167 |
| Y Patch | CCTCCTCTTCCCCCCCTCCT | - | 1774734 | 1774753 | -170 | -189 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CTCTCCGC | - | 1774771 | 1774778 | -207 | -214 | |||
| OsREG576 | CTCTCCGC | PPDB Motif | PLACE Motif | ||||||
| REG | CCGTGGGCCCCCAC | - | 1774836 | 1774849 | -272 | -285 | |||
| OsREG547 | CCGTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG571 | CGTGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG640 | GTGGGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG647 | TGGGCCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG613 | GCCCCCAC | PPDB Motif | PLACE Motif | ||||||
| REG | GGTCCACGTGGGGGCCCACCC | - | 1774879 | 1774899 | -315 | -335 | |||
| OsREG570 | GGTCCACG | PPDB Motif | PLACE Motif | ||||||
| OsREG508 | CACGTGGG | PPDB Motif | ACGT | PLACE Motif | |||||
| OsREG450 | ACGTGGGG | PPDB Motif | ACGT | PLACE Motif | |||||
| OsREG536 | CGTGGGGG | PPDB Motif | PLACE Motif | ||||||
| OsREG613 | GTGGGGGC | PPDB Motif | PLACE Motif | ||||||
| OsREG647 | GGGGCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG640 | GGGCCCAC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG628 | GGCCCACC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG600 | GCCCACCC | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||