version
PlantPromoterDB promoter information of AK100732

Summary of Gene (AK100732)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0150300        NCBI 
Gene model AK100732  
Description Similar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1).  
#
#

Overview

Focused view (chromosome 5: 2851581-2852780)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK100732                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100732

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2852371-210

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCTT+28523772852384-204-197
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAGGCCCACT+28521982852207-383-374
 OsREG430AAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478  GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCATT+28522142852223-367-358
 OsREG655TAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGCCAGCCCAAG+28522462852255-335-326
 OsREG523CCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG459  AGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGGCCCGGCCC+28522762852284-305-297
 OsREG614GCCCGGCC  PPDB Motif  PLACE Motif 
 OsREG538 CCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCCCCACACG+28522902852298-291-283
 OsREG535CCCCACAC  PPDB Motif  PLACE Motif 
 OsREG526 CCCACACG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.