version
PlantPromoterDB promoter information of AK100935

Summary of Gene (AK100935)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0282400        NCBI 
Gene model AK100935  
Description Similar to Alpha-SNAP (Fragment).  
#
#

Overview

Focused view (chromosome 8: 11100867-11102066)

Genome position     
from initiation codon
J023034I10          
J023036A16          
J023136I24          
J065057J05          
J065146L17          
J065181P18          
J075032P11          
J075048E17          
J075085C10          
J075090F12          
J075102N11          
J075108M08          
J075125A19          
J075132E14          
J075133M04          
J075153J06          
J090077L16          
TSS from cDNA
TSS information
AK100935                         5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100935

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+11101731-136

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCTCCTCTT+1110173311101746-134-121
Y PatchCCTTCTCC+1110175111101758-116-109
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACTGACAGG+1110148011101488-387-379
 OsREG453ACTGACAG  PPDB Motif  PLACE MotifTGAC 
 OsREG551 CTGACAGG PPDB Motif  PLACE MotifTGAC 
REGCCACGTGT+1110162111101628-246-239
 OsREG434CCACGTGT PPDB MotifACGT  PLACE Motif 
REGCCCACTTG+1110163811101645-229-222
 OsREG498CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGCCCCACA+1110166311101675-204-192
 OsREG628GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611     GCCCCACA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.