version
PlantPromoterDB promoter information of AK101046

Summary of Gene (AK101046)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0789600        NCBI 
Gene model AK101046  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 34433234-34434433)

Genome position     
from initiation codon
016-054-A06         
AK112100            
TSS from cDNA
TSS information
AK101046                         5'->3' (+)
Promoter sequence





 
AK073210            
AK073359            
J033027A21          
J100083J05          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK101046

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+34434158-76

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATACCCC+3443412334434130-111-104
Y PatchCCCCCCTCTC+3443412734434136-107-98
Y PatchTTCCCCTC+3443415034434157-84-77
Y PatchCCCCCCTCCC+3443417234434181-62-53
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAACGGTC+3443389734433904-337-330
 OsREG495CAACGGTC PPDB MotifCCAACGG  PLACE Motif 
REGCAAGTGGGCCCT+3443401134434022-223-212
 OsREG498CAAGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG478  AGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475    TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGCGCGTCGCGTC+3443405034434060-184-174
 OsREG559CGCGTCGC    PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG   PPDB Motif  PLACE MotifCGACG 
 OsREG583   GTCGCGTC PPDB Motif  PLACE Motif 
REGGCCACGTGGCG+3443410334434113-131-121
 OsREG507GCCACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448   ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.