version
PlantPromoterDB promoter information of AK101108

Summary of Gene (AK101108)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0733300        NCBI 
Gene model AK101108  
Description Similar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4).  
#
#

Overview

Focused view (chromosome 2: 31459534-31460733)

Genome position     
from initiation codon
012-092-A05         
AK105446            
J033025E01          
J065212P03          
J075090N24          
J075116I20          
J075120K15          
TSS from cDNA
TSS information
AK101108                         5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK101108

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+31460315-219
TSS clone peakGclone+31460320-214

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCAACGGCCGAAA+3146002231460035-512-499
 OsREG548TCCAACGG       PPDB MotifCCAACGG  PLACE Motif 
 OsREG518 CCAACGGC      PPDB MotifCCAACGG  PLACE Motif 
 OsREG494  CAACGGCC     PPDB MotifCCAACGG  PLACE Motif 
 OsREG634      GGCCGAAA PPDB Motif  PLACE Motif 
REGCCACGCGT+3146010331460110-431-424
 OsREG443CCACGCGT PPDB Motif  PLACE Motif 
REGTCCAACGGTCCCACCCG+3146016531460181-369-353
 OsREG548TCCAACGG          PPDB MotifCCAACGG  PLACE Motif 
 OsREG495  CAACGGTC        PPDB MotifCCAACGG  PLACE Motif 
 OsREG650      GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG651       GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG528         CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGTCCGTCCGA+3146018631460194-348-340
 OsREG561TCCGTCCG  PPDB Motif  PLACE Motif 
 OsREG545 CCGTCCGA PPDB Motif  PLACE Motif 
REGCATCCACC+3146025731460264-277-270
 OsREG515CATCCACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.