version
PlantPromoterDB promoter information of AK101331

Summary of Gene (AK101331)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0224200        NCBI 
Gene model AK101331  
Description Similar to Ythdf2-prov protein.  
#
#

Overview

Focused view (chromosome 8: 7562363-7561164)

Genome position     
from initiation codon
011-048-B09         
J013089F02          
J013111C07          
J013135E11          
J013149H09          
J023001C23          
J023114D06          
J023134J01          
J023148O06          
J023150A16          
J033027M17          
J033028A08          
J033034H04          
J033066P10          
J033069G24          
J033076B03          
J033076I17          
J033090J23          
J033091M08          
J033113O11          
J043005G23          
J043021P17          
J043022D18          
J053067L05          
J090015E01          
J090049K18          
J090056C24          
J090094F04          
J100066P12          
J100069N23          
TSS from cDNA
TSS information
AK101331                         5'->3' (-)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK101331

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-7562176-813

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCCCTC-75621597562166-796-803
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCTGGCCC-75622987562305-935-942
 OsREG638TCTGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCACA-75623377562346-974-983
 OsREG618GCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG564 CGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGGGCCGGGCCTGGGCCGTG-75623567562373-993-1010
 OsREG614GGCCGGGC           PPDB Motif  PLACE Motif 
 OsREG616 GCCGGGCC          PPDB Motif  PLACE Motif 
 OsREG524    GGGCCTGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG550       CCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565        CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445         TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504          GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGCTCGGCCCAGG-75623777562387-1014-1024
 OsREG575CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550   GGCCCAGG PPDB MotifGCCCA  PLACE Motif 
REGCGGGCCGTGCCGGCCC-75623957562410-1032-1047
 OsREG446CGGGCCGT         PPDB MotifACGGGC  PLACE Motif 
 OsREG504 GGGCCGTG        PPDB MotifGCCCA  PLACE Motif 
 OsREG615        GCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGGACGGCCCGGT-75624197562431-1056-1068
 OsREG562CGGACGGC      PPDB Motif  PLACE Motif 
 OsREG624 GGACGGCC     PPDB Motif  PLACE Motif 
 OsREG584  GACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG446   ACGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544    CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG441     GGCCCGGT PPDB Motif  PLACE Motif 
REGCACGTGGGCTGG-75624347562445-1071-1082
 OsREG508CACGTGGG     PPDB MotifACGT  PLACE Motif 
 OsREG449 ACGTGGGC    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG463  CGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG523    TGGGCTGG PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGCCGTGCCTGGGCCGTG-75624537562475-1090-1112
 OsREG594TGTTGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC               PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG              PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG   GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
 OsREG550            CCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565             CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.