version
PlantPromoterDB promoter information of AK101530

Summary of Gene (AK101530)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0150800        NCBI 
Gene model AK101530  
Description Similar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS.  
#
#

Overview

Focused view (chromosome 8: 2922289-2923488)

Genome position     
from initiation codon
015-009-E08         
J013044G21          
J023085B06          
J065042I01          
J065058F12          
J065070K12          
J065094M21          
J090091J01          
TSS from cDNA
TSS information
AK101530                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK101530

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+2923249-40

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCTC+29232312923239-58-50
Y PatchCCCTTCTCC+29232582923266-31-23
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCAATT+29229672922975-322-314
 OsREG460AGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433 GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACGT+29229852922993-304-296
 OsREG463AGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449 GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
REGAAATGGGCTCGGCCCACA+29230222923039-267-250
 OsREG422AAATGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG575       CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG658        TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG564         CGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627          GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCGA+29230562923065-233-224
 OsREG581CTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG563 TTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TGGGCCGA PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCACGTC+29230832923095-206-194
 OsREG627TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG654 GTGGGCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG653  TGGGCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG585     GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCTTGGGCCCACTTG+29231012923114-188-175
 OsREG581CTTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG639 TTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478    GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG498      CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGGATCGGACGGC+29231742923184-115-105
 OsREG589GATCGGAC    PPDB Motif  PLACE Motif 
 OsREG484 ATCGGACG   PPDB Motif  PLACE Motif 
 OsREG545  TCGGACGG  PPDB Motif  PLACE Motif 
 OsREG562   CGGACGGC PPDB Motif  PLACE Motif 
REGCGCGGGGG+29231932923200-96-89
 OsREG537CGCGGGGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.