version
PlantPromoterDB promoter information of AK101539

Summary of Gene (AK101539)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0535900        NCBI 
Gene model AK101539  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 26677364-26678563)

Genome position     
from initiation codon
AK101555            
J013025O04          
J013047J05          
J023061B12          
J023150K13          
J033027G21          
J033039D11          
J033050A17          
J033071D13          
J033130B19          
TSS from cDNA
TSS information
AK101539                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK101539

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+26677785-579

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAGGCCCCACACGTCAC+2667752826677545-836-819
 OsREG497CAAGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC        PPDB Motif  PLACE Motif 
 OsREG611    GCCCCACA       PPDB Motif  PLACE Motif 
 OsREG535     CCCCACAC      PPDB Motif  PLACE Motif 
 OsREG526      CCCACACG     PPDB MotifGCCCA  PLACE Motif 
 OsREG505          CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGGGAGTGGGACCCAC+2667756026677573-804-791
 OsREG532GGAGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG650   GTGGGACC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648    TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637     GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622      GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGTGTCAGTG+2667757526677582-789-782
 OsREG510TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGGGACGGAC+2667762626677633-738-731
 OsREG623GGACGGAC PPDB Motif  PLACE Motif 
REGGGTGGGGCCCGCA+2667766026677672-704-692
 OsREG612GGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG567   GGGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG619    GGGCCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG632     GGCCCGCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.