version
PlantPromoterDB promoter information of AK101549

Summary of Gene (AK101549)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0308300        NCBI 
Gene model AK101549  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 11769340-11768141)

Genome position     
from initiation codon
011-078-G06         
AK059211            
AK102553            
J023087M24          
J033029C19          
J033035C05          
J033066N24          
J033085E19          
J033097E23          
J033103G14          
J033140E07          
J033140K01          
J033141D05          
J033142E07          
J033142K01          
J033150F04          
J043001D21          
J043022J23          
J043040B16          
J075009F01          
J075022A15          
J075048C06          
J075120F05          
J075121A18          
J075147H11          
J075165F01          
J090014G18          
J090035H23          
J090045L10          
J090078D04          
J090079E16          
J090082B01          
J090082G05          
J090086H02          
J100025L17          
TSS from cDNA
TSS information
AK101549                         5'->3' (-)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK101549

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-11769294-954
TSS clone peakAclone-11769291-951

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCCCC-1176933011769339-990-999
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTCGGATCGG-1176939311769404-1053-1064
 OsREG546CCGTCGGA     PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483 CGTCGGAT    PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588  GTCGGATC   PPDB MotifCCGAC  PLACE Motif 
 OsREG541    CGGATCGG PPDB Motif  PLACE Motif 
REGCGACCCGCGC-1176943311769442-1093-1102
 OsREG552CGACCCGC   PPDB Motif  PLACE Motif 
 OsREG439  ACCCGCGC PPDB Motif  PLACE Motif 
REGTGGGGCCCACACG-1176948811769500-1148-1160
 OsREG641TGGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647 GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG627   GGCCCACA   PPDB MotifGCCCA  PLACE Motif 
 OsREG598    GCCCACAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG526     CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGCACGGCCCG-1176955711769565-1217-1225
 OsREG504CACGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG PPDB MotifACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.