version
PlantPromoterDB promoter information of AK101608

Summary of Gene (AK101608)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0532400        NCBI 
Gene model AK101608  
Description Similar to AT.I.24-7 protein.  
#
#

Overview

Focused view (chromosome 8: 26626150-26627349)

Genome position     
from initiation codon
012-047-G11         
J033052A20          
J033107A06          
J090030E21          
J090054C05          
TSS from cDNA
TSS information
AK101608                         5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK101608

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+26625677-223

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTC+2662564326625650-257-250
Y PatchTCCTCCTCCCC+2662568926625699-211-201
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTACTGGGCCGGA+2662540626625417-494-483
 OsREG604TACTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCCGTA+2662542126625432-479-468
 OsREG605TTATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG645    GGGCCGTA PPDB MotifGCCCA  PLACE Motif 
REGGCCCAACA+2662543526625442-465-458
 OsREG594GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGAGGTGGGCCCACAAACTGACAGG+2662548126625503-419-397
 OsREG476AGGTGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCCAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG627     GGCCCACA           PPDB MotifGCCCA  PLACE Motif 
 OsREG597      GCCCACAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG453              ACTGACAG  PPDB Motif  PLACE MotifTGAC 
 OsREG551               CTGACAGG PPDB Motif  PLACE MotifTGAC 
REGGCCACGTGTCG+2662556926625579-331-321
 OsREG507GCCACGTG    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509  CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG452   ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.