version
PlantPromoterDB promoter information of AK101717

Summary of Gene (AK101717)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0178100        NCBI 
Gene model AK101717  
Description Pep3/Vps18/deep orange domain containing protein.  
#
#

Overview

Focused view (chromosome 8: 4569089-4570288)

Genome position     
from initiation codon
J033060O03          
J033123P09          
TSS from cDNA
TSS information
AK101717                         5'->3' (+)
Promoter sequence










 
014-080-H04         
015-016-D05         
J090034E10          
J090034F22          
J090087I15          
J100068N09          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK101717

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+4570025-64

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCCTCC+45699814569990-108-99
Y PatchTCTCCTCTCC+45700134570022-76-67
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAATTGGGC+45698814569888-208-201
 OsREG433AATTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCAGA+45699174569928-172-161
 OsREG610TAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG638    GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCTTC+45699304569940-159-149
 OsREG596TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG460 ATTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG582   TGGGCTTC PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCACGGCCCATGA+45699444569963-145-126
 OsREG433AATTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC          PPDB MotifGCCCA  PLACE Motif 
 OsREG521       CCACGGCC      PPDB Motif  PLACE Motif 
 OsREG504        CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445         ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490          CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517           GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609            GCCCATGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.