version
PlantPromoterDB promoter information of AK101798

Summary of Gene (AK101798)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0540600        NCBI 
Gene model AK101798  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 22107167-22108366)

Genome position     
from initiation codon
AK103397            
J033066F16          
J033127N09          
TSS from cDNA
TSS information
AK101798                         5'->3' (+)
Promoter sequence










 
012-035-E05         
015-079-C11         
AK120729            
J023003B04          
J075083D17          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK101798

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+22108089-78
TSS clone peakGclone+22108092-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTTGGGC+2210784222107849-325-318
 OsREG595GGTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCTAATGGGCCTC+2210798922108007-178-160
 OsREG610TAATGGGCTAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG431         AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474          ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587           TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCTTTACGGCCCATAAAAGCCCATTA+2210801922108050-148-117
 OsREG480ATATGGGC                         PPDB MotifGCCCA  PLACE Motif 
 OsREG465 TATGGGCT                        PPDB MotifGCCCA  PLACE Motif 
 OsREG645          TACGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG445           ACGGCCCA              PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490            CGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG630             GGCCCATA            PPDB MotifGCCCA  PLACE Motif 
 OsREG605              GCCCATAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG419                    AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT          AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT            AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432                       AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610                        GCCCATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.