version
PlantPromoterDB promoter information of AK101869

Summary of Gene (AK101869)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0782200        NCBI 
Gene model AK101869  
Description NOT2/NOT3/NOT5 domain containing protein.  
#
#

Overview

Focused view (chromosome 2: 34054103-34052904)

Genome position     
from initiation codon
003-014-C04         
011-038-F04         
AK060779            
AK070439            
J013030L17          
J013060L01          
J013070A20          
J013098E02          
J023039O05          
J023054G23          
J023062C01          
J023102K09          
J023133C16          
J033025K22          
J033070E05          
J100074H22          
TSS from cDNA
TSS information
AK101869                         5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK101869

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-34055854-1001
TSS clone peakCclone-34055818-965

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCCT-3405581634055824-963-971
Y PatchTTCTCCTCCC-3405582634055835-973-982
Y PatchTCTTCCTCC-3405584234055850-989-997
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCAACT-3405586134055869-1008-1016
 OsREG458AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479 GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGTACGGCCCAGA-3405587134055881-1018-1028
 OsREG645TACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629   GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGTCTGGCCCATCA-3405589634055907-1043-1054
 OsREG638TCTGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG577 CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488  TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607    GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCATGA-3405591534055925-1062-1072
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609   GCCCATGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone-34053678AK060779

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.