version
PlantPromoterDB promoter information of AK101954

Summary of Gene (AK101954)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0503800        NCBI 
Gene model AK101954  
Description Similar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38).  
#
#

Overview

Focused view (chromosome 8: 24974871-24976070)

Genome position     
from initiation codon
J090003M24          
TSS from cDNA
TSS information
AK101954                         5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK101954

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+24975778-93

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCGTCC+2497556624975573-305-298
 OsREG468AGCCGTCC PPDB Motif  PLACE Motif 
REGAGCCGTCCGATCTGGTGGGCCCACAC+2497561924975644-252-227
 OsREG468AGCCGTCC                   PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG                  PPDB Motif  PLACE Motif 
 OsREG545  CCGTCCGA                 PPDB Motif  PLACE Motif 
 OsREG484   CGTCCGAT                PPDB Motif  PLACE Motif 
 OsREG589    GTCCGATC               PPDB Motif  PLACE Motif 
 OsREG599            TGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628             GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640              GTGGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627                 GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598                  GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGCACTGACATGTGGGCCCCAC+2497567724975696-194-175
 OsREG510CACTGACA             PPDB Motif  PLACE MotifTGAC 
 OsREG627        TGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640         GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647          TGGGCCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG641           GGGCCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG631            GGCCCCAC PPDB Motif  PLACE Motif 
REGATGGCCCACACG+2497570424975715-167-156
 OsREG487ATGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA   PPDB MotifGCCCA  PLACE Motif 
 OsREG598   GCCCACAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG526    CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGAGTGACAC+2497571824975725-153-146
 OsREG477AGTGACAC PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.