version
PlantPromoterDB promoter information of AK102201

Summary of Gene (AK102201)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0295400        NCBI 
Gene model AK102201  
Description Similar to Ferredoxin.  
#
#

Overview

Focused view (chromosome 3: 10376269-10375070)

Genome position     
from initiation codon
016-016-A01         
J023044B09          
J033087E17          
TSS from cDNA
TSS information
AK102201                         5'->3' (-)
Promoter sequence

 
009-083-F02         
J053029J05          
J053054B07          
J053069A12          
J065024G23          
J065036F08          
J065066M11          
J065143G19          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK102201

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+10375688J053054B07, J053029J05, J053054B07, J065066M11, J065143G19, J065036F08, 009-083-F02, J065024G23

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCCTCC+1037564310375654009-083-F02, J053029J05, J053054B07, J065024G23, J065036F08, J065066M11, J065143G19
Y PatchTCCTCTCC+1037565910375666009-083-F02, J053029J05, J053054B07, J065024G23, J065036F08, J065066M11, J065143G19
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGTGTGGC+1037546610375473009-083-F02, J053029J05, J053054B07, J065024G23, J065036F08, J065066M11, J065143G19
 OsREG573CGTGTGGC PPDB Motif  PLACE Motif 
REGTGTGGGCCAGA+1037550110375511009-083-F02, J053029J05, J053054B07, J065024G23, J065036F08, J065066M11, J065143G19
 OsREG627TGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG654 GTGGGCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG577  TGGGCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG638   GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCATATAAGGCCCAACT+1037554010375561009-083-F02, J053029J05, J053054B07, J065024G23, J065036F08, J065066M11, J065143G19
 OsREG660TTGGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT              PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA             PPDB MotifGCCCA  PLACE Motif 
 OsREG480   GCCCATAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG430           AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471            AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626             GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479              GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCCACGAA+1037558710375599009-083-F02, J053029J05, J053054B07, J065024G23, J065036F08, J065066M11, J065143G19
 OsREG419AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG427  AAGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG463   AGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG601    GCCCACGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG529     CCCACGAA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.