version
PlantPromoterDB promoter information of AK102319

Summary of Gene (AK102319)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0618200        NCBI 
Gene model AK102319  
Description Protein phosphatase 2C family protein.  
#
#

Overview

Focused view (chromosome 1: 26240500-26241699)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK102319                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK102319

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+26241201-299

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCCCT+2624118226241191-318-309
Y PatchCCTCCCTCCCCC+2624122326241234-277-266
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTTGGGCCCACCTGACAGG+2624091426240933-586-567
 OsREG594TGTTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC            PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG639  TTGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC        PPDB MotifGCCCA  PLACE Motif 
 OsREG476      GCCCACCT       PPDB MotifGCCCA  PLACE Motif 
 OsREG514       CCCACCTG      PPDB MotifGCCCA  PLACE Motif 
 OsREG551            CTGACAGG PPDB Motif  PLACE MotifTGAC 
REGCCCCCGCG+2624097926240986-521-514
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGCCACCAAC+2624101126241018-489-482
 OsREG520CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGCACTGACAAATGGGCCCACA+2624102726241046-473-454
 OsREG510CACTGACA             PPDB Motif  PLACE MotifTGAC 
 OsREG422       AAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG431        AATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489         ATGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640           GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627            GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGGGTCCCAC+2624105326241060-447-440
 OsREG650GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGCCTGGGCCAGCCCACCA+2624108126241097-419-403
 OsREG550CCTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG578 CTGGGCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG577  TGGGCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG523      CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG462        AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599         GCCCACCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.