version
PlantPromoterDB promoter information of AK102487

Summary of Gene (AK102487)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0194600        NCBI 
Gene model AK102487  
Description Peptidase M22, O-sialoglycoprotein endopeptidase family protein.  
#
#

Overview

Focused view (chromosome 5: 5780171-5778972)

Genome position     
from initiation codon
J100032M01          
J100041A08          
TSS from cDNA
TSS information
AK102487                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK102487

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-5779213-42

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTCGGCCCG-57792645779273-93-102
 OsREG634TTTCGGCC   PPDB Motif  PLACE Motif 
 OsREG642 TTCGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG568  TCGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGTTTTGGGCTTAAGGGCCCAATT-57792835779304-112-133
 OsREG592TTTTGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT              PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT             PPDB MotifGCCCA  PLACE Motif 
 OsREG655   TGGGCTTA            PPDB MotifGCCCA  PLACE Motif 
 OsREG475           AGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG639            GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492             GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433              GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGCTGGGCTTC-57793225779330-151-159
 OsREG428CTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG582 TGGGCTTC PPDB MotifGCCCA  PLACE Motif 
REGAATGGGCTATTGGGCCGA-57793385779355-167-184
 OsREG432AATGGGCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG596       TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG492        ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG563         TTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG658          TGGGCCGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.