PlantPromoterDB promoter information of AK102651
Summary of Gene (AK102651)
|
Overview
|
Focused view (chromosome 3: 5143991-5145190)
|
Genome position
from initiation codon 012-025-F12 012-045-B09 012-047-E09 012-074-E08 015-062-A09 TSS from cDNA TSS information AK102651 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence |
|
|
|
Promoter Summary of AK102651
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | G | clone | + | 5143771 | -70 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | TGCCTATA | + | 5143733 | 5143740 | -108 | -101 |
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CACACACC | + | 5143528 | 5143535 | -313 | -306 | |||
| OsREG499 | CACACACC | PPDB Motif | PLACE Motif | ||||||
| REG | GCCACGTC | + | 5143662 | 5143669 | -179 | -172 | |||
| OsREG585 | GCCACGTC | PPDB Motif | ACGT | PLACE Motif | ACGTGKC | ||||
| REG | CACGCCACGCCACCCCCACGTCGCGCGC | + | 5143690 | 5143717 | -151 | -124 | |||
| OsREG502 | CACGCCACGCCAC | PPDB Motif | PLACE Motif | ||||||
| OsREG536 | CCCCCACG | PPDB Motif | PLACE Motif | ||||||
| OsREG450 | CCCCACGT | PPDB Motif | ACGT | PLACE Motif | |||||
| OsREG557 | GTCGCGCG | PPDB Motif | ACGCGC | PLACE Motif | |||||
| OsREG617 | TCGCGCGC | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||