version
PlantPromoterDB promoter information of AK102681

Summary of Gene (AK102681)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0530600        NCBI 
Gene model AK102681  
Description BRCT domain containing protein.  
#
#

Overview

Focused view (chromosome 2: 20373744-20372545)

Genome position     
from initiation codon
J075004K11          
J075024O04          
J075031K02          
J075067K01          
J075087G22          
J075097A07          
J075109O12          
J075110K07          
J075117C17          
J075143O07          
J075146F13          
J075166I18          
J075176N09          
J075182F16          
TSS from cDNA
TSS information
AK102681                         5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK102681

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-20372797-53

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACTCC-2037286920372876-125-132
 OsREG532CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGGGGTGGGCTACGTGTCG-2037293320372949-189-205
 OsREG600GGGTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG462 GGTGGGCT         PPDB MotifGCCCA  PLACE Motif 
 OsREG452         ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTCCCACCCCCACG-2037301220373025-268-281
 OsREG651GTCCCACC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG536      CCCCCACG PPDB Motif  PLACE Motif 
REGCCCCCACGTCTCGCGTCTC-2037303320373051-289-307
 OsREG536CCCCCACG            PPDB Motif  PLACE Motif 
 OsREG450 CCCCACGT           PPDB MotifACGT  PLACE Motif 
 OsREG506    CACGTCTC        PPDB MotifACGT  PLACE Motif 
 OsREG560           CGCGTCTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.