version
PlantPromoterDB promoter information of AK102727

Summary of Gene (AK102727)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0346400        NCBI 
Gene model AK102727  
Description Protein of unknown function DUF538 family protein.  
#
#

Overview

Focused view (chromosome 5: 16283422-16284621)

Genome position     
from initiation codon
009-023-F03         
AK058872            
J033105N07          
J100077I17          
TSS from cDNA
TSS information
AK102727                         5'->3' (+)
Promoter sequence





 
004-012-C12         
AF529175            
AK061627            
AK103081            
AK104191            
J013049B09          
J023142E24          
J033052M14          
J033089N04          
J033118F01          
J065054E07          
J065066L18          
J065078C21          
J065127G23          
J065128N24          
J065144P17          
J065147P14          
J065170E16          
J065175D17          
J065176M05          
J065218G20          
J090074J12          
J100019H16          
J100031N24          
J100072G08          
J100086I23          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK102727

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+16284322-100

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTC+1628433516284342-87-80
Y PatchTCTCCCCC+1628435016284357-72-65
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAAGCCCATCT+1628402516284036-397-386
 OsREG519CCAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG496 CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466   AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456    GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTCAC+1628405316284062-369-360
 OsREG585GCCACGTC   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505  CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGGCCACGTCAC+1628410016284109-322-313
 OsREG585GCCACGTC   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505  CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGTCGTGGGC+1628416116284168-261-254
 OsREG601TCGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGGTCCACG+1628417416284186-248-236
 OsREG441GGCCCGGT      PPDB Motif  PLACE Motif 
 OsREG570     GGTCCACG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone-16283947AK061627, J065147P14, J065176M05, AK061627, AK104191, J033052M14, J065054E07, J065066L18, J065078C21, J065127G23, J065128N24, J065144P17, J065170E16, J065175D17, J065218G20, J090074J12, J100019H16, J100031N24, J100072G08, J100086I23, J023142E24, AF529175, 009-033-C06, AK103081, J013049B09, J033118F01, J033089N04

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTATATAAGCA-1628397016283980009-033-C06, AF529175, AK061627, AK103081, AK104191, J013049B09, J023142E24, J033052M14, J033089N04, J033118F01, J065054E07, J065066L18, J065078C21, J065127G23, J065128N24, J065144P17, J065147P14, J065170E16, J065175D17, J065176M05, J065218G20, J090074J12, J100019H16, J100031N24, J100072G08, J100086I23
Y PatchCCCTTCTCC-1628390816283916009-033-C06, AF529175, AK061627, AK103081, AK104191, J013049B09, J023142E24, J033052M14, J033089N04, J033118F01, J065054E07, J065066L18, J065078C21, J065127G23, J065128N24, J065144P17, J065147P14, J065170E16, J065175D17, J065176M05, J065218G20, J090074J12, J100019H16, J100031N24, J100072G08, J100086I23
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCGGCCCAGCAAGGCCCATCG-1628399216284012009-033-C06, AF529175, AK061627, AK103081, AK104191, J013049B09, J023142E24, J033052M14, J033089N04, J033118F01, J065054E07, J065066L18, J065078C21, J065127G23, J065128N24, J065144P17, J065147P14, J065170E16, J065175D17, J065176M05, J065218G20, J090074J12, J100019H16, J100031N24, J100072G08, J100086I23
 OsREG618GCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CGGCCCAG             PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG497         CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430          AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474           AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590            GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG553             GCCCATCG PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCTTGGGCTTT-1628402016284036009-033-C06, AF529175, AK061627, AK103081, AK104191, J013049B09, J023142E24, J033052M14, J033089N04, J033118F01, J065054E07, J065066L18, J065078C21, J065127G23, J065128N24, J065144P17, J065147P14, J065170E16, J065175D17, J065176M05, J065218G20, J090074J12, J100019H16, J100031N24, J100072G08, J100086I23
 OsREG456AGATGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT         PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT        PPDB MotifGCCCA  PLACE Motif 
 OsREG496   TGGGCTTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG519    GGGCTTGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG459       CTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426        TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421         TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGGTGACGTGGC-1628405316284062009-033-C06, AF529175, AK061627, AK103081, AK104191, J013049B09, J023142E24, J033052M14, J033089N04, J033118F01, J065054E07, J065066L18, J065078C21, J065127G23, J065128N24, J065144P17, J065147P14, J065170E16, J065175D17, J065176M05, J065218G20, J090074J12, J100019H16, J100031N24, J100072G08, J100086I23
 OsREG505GTGACGTG   PPDB MotifACGT  PLACE MotifTGAC 
 OsREG585  GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTGACGTGGC-1628410016284109009-033-C06, AF529175, AK061627, AK103081, AK104191, J013049B09, J023142E24, J033052M14, J033089N04, J033118F01, J065054E07, J065066L18, J065078C21, J065127G23, J065128N24, J065144P17, J065147P14, J065170E16, J065175D17, J065176M05, J065218G20, J090074J12, J100019H16, J100031N24, J100072G08, J100086I23
 OsREG505GTGACGTG   PPDB MotifACGT  PLACE MotifTGAC 
 OsREG585  GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCCACGA-1628416116284168009-033-C06, AF529175, AK061627, AK103081, AK104191, J013049B09, J023142E24, J033052M14, J033089N04, J033118F01, J065054E07, J065066L18, J065078C21, J065127G23, J065128N24, J065144P17, J065147P14, J065170E16, J065175D17, J065176M05, J065218G20, J090074J12, J100019H16, J100031N24, J100072G08, J100086I23
 OsREG601GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGCGTGGACCGGGCC-1628417416284186009-033-C06, AF529175, AK061627, AK103081, AK104191, J013049B09, J023142E24, J033052M14, J033089N04, J033118F01, J065054E07, J065066L18, J065078C21, J065127G23, J065128N24, J065144P17, J065147P14, J065170E16, J065175D17, J065176M05, J065218G20, J090074J12, J100019H16, J100031N24, J100072G08, J100086I23
 OsREG570CGTGGACC      PPDB Motif  PLACE Motif 
 OsREG441     ACCGGGCC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.