version
PlantPromoterDB promoter information of AK102756

Summary of Gene (AK102756)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0573600        NCBI 
Gene model AK102756  
Description Similar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase).  
#
#

Overview

Focused view (chromosome 6: 23121735-23122934)

Genome position     
from initiation codon
013-065-B05         
J023001F23          
J033107B05          
J090078G02          
J090099E09          
TSS from cDNA
TSS information
AK102756                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK102756

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+23122389-346

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCC+2312235723122364-378-371
Y PatchTCTTCCTCCCCT+2312237723122388-358-347
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCTGGGCTGA+2312213823122147-597-588
 OsREG464GCTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG657  TGGGCTGA PPDB MotifGCCCA  PLACE Motif 
REGAGTGGGCCCCACACGTCTC+2312229723122315-438-420
 OsREG478AGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC        PPDB Motif  PLACE Motif 
 OsREG611     GCCCCACA       PPDB Motif  PLACE Motif 
 OsREG535      CCCCACAC      PPDB Motif  PLACE Motif 
 OsREG526       CCCACACG     PPDB MotifGCCCA  PLACE Motif 
 OsREG506           CACGTCTC PPDB MotifACGT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.