version
PlantPromoterDB promoter information of AK102792

Summary of Gene (AK102792)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0586700        NCBI 
Gene model AK102792  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 7: 24506529-24505330)

Genome position     
from initiation codon
011-074-D01         
J033107P15          
J065183B03          
J075104H15          
J090022J24          
J090085E06          
TSS from cDNA
TSS information
AK102792                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK102792

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-24505612-83

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGGCCCAAACCCAGCCCAAAA-2450566324505685-134-156
 OsREG504CACGGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA               PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563  CGGCCCAA              PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG593    GCCCAAAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG533           CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523            CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511             CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457              AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592               GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGCCAGGCCCGGGTCGGATC-2450569824505715-169-186
 OsREG524CCAGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG539   GGCCCGGG        PPDB Motif  PLACE Motif 
 OsREG588          GTCGGATC PPDB MotifCCGAC  PLACE Motif 
REGATCCAACGGCC-2450576324505773-234-244
 OsREG481ATCCAACG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG518  CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG494   CAACGGCC PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.