version
PlantPromoterDB promoter information of AK102796

Summary of Gene (AK102796)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0134000        NCBI 
Gene model AK102796  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 1826360-1825161)

Genome position     
from initiation codon
J065077K22          
J075199J24          
TSS from cDNA
TSS information
AK102796                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK102796

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-1825384-24

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCGGCCCAACCGGCCCACCC-18254291825449-69-89
 OsREG644TCCGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC           PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595    GCCCAACC          PPDB MotifGCCCA  PLACE Motif 
 OsREG440         ACCGGCCC     PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG564           CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628            GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600             GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGAGGTGGGCCAA-18254511825461-91-101
 OsREG476AGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654  GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGGCCCAGCCCACCT-18254901825502-130-142
 OsREG603GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533 CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523  CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG462    AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476     GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGCCATGGGCCAG-18255061825516-146-156
 OsREG525CCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGGGGCCCCA-18256761825683-316-323
 OsREG641GGGCCCCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.