version
PlantPromoterDB promoter information of AK102854

Summary of Gene (AK102854)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0324400        NCBI 
Gene model AK102854  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 12551556-12550357)

Genome position     
from initiation codon
AK102490            
AK111299            
J033032A11          
J033094O03          
J033110L02          
TSS from cDNA
TSS information
AK102854                         5'->3' (-)
Promoter sequence












 
                    
Os01g0324600        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK102854

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-12550662-106

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACAGCCCAGCCCACCAGGCCCACA-1255074712550770-191-214
 OsREG435ACAGCCCA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAG                PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG523     CCAGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG462       AGCCCACC          PPDB MotifGCCCA  PLACE Motif 
 OsREG599        GCCCACCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG524             CCAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG513              CAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG472               AGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627                GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-1255082712550834-271-278
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGGCCACGTGGG-1255095012550959-394-403
 OsREG507GCCACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG508  CACGTGGG PPDB MotifACGT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.