version
PlantPromoterDB promoter information of AK103084

Summary of Gene (AK103084)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0762400        NCBI 
Gene model AK103084  
Description Cyclin-dependent kinase inhibitor family protein.  
#
#

Overview

Focused view (chromosome 2: 32997231-32998430)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK103084                         5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103084

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+32998172-59

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGCGAC+3299792032997927-311-304
 OsREG583GACGCGAC PPDB Motif  PLACE Motif 
REGGCAGCCCAACGGCC+3299794132997954-290-277
 OsREG591GCAGCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA      PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC     PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG518     CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG494      CAACGGCC PPDB MotifCCAACGG  PLACE Motif 
REGCGCGGGGG+3299798832997995-243-236
 OsREG537CGCGGGGG PPDB Motif  PLACE Motif 
REGCCGTCGGATCGG+3299800632998017-225-214
 OsREG546CCGTCGGA     PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483 CGTCGGAT    PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588  GTCGGATC   PPDB MotifCCGAC  PLACE Motif 
 OsREG541    CGGATCGG PPDB Motif  PLACE Motif 
REGCCTCGCCC+3299802932998036-202-195
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 
REGGCGACGCGACGCG+3299806032998072-171-159
 OsREG559GCGACGCGACGCG PPDB Motif  PLACE MotifCGACG 
 OsREG583  GACGCGAC    PPDB Motif  PLACE Motif 
 OsREG556    CGCGACGC  PPDB Motif  PLACE MotifCGACG 
REGCGGACGGA+3299807832998085-153-146
 OsREG561CGGACGGA PPDB Motif  PLACE Motif 
REGTGGGGGAG+3299810932998116-122-115
 OsREG574TGGGGGAG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.