version
PlantPromoterDB promoter information of AK103090

Summary of Gene (AK103090)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0958100        NCBI 
Gene model AK103090  
Description Similar to Chloroplast SRP receptor cpFtsY precursor.  
#
#

Overview

Focused view (chromosome 1: 44033237-44032038)

Genome position     
from initiation codon
006-080-A05         
AK058574            
AK109369            
J033118J07          
TSS from cDNA
TSS information
AK103090                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103090

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-44032285-48
TSS clone peakGclone-44032239-2

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTTCCTCTCCCC-44032204440322183319
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTCGGCC-4403233444032341-97-104
 OsREG634TTTCGGCC PPDB Motif  PLACE Motif 
REGCAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCT-4403234744032382-110-145
 OsREG498CAAGTGGG                             PPDB MotifGCCCA  PLACE Motif 
 OsREG427   GTGGGCTT                          PPDB MotifGCCCA  PLACE Motif 
 OsREG421    TGGGCTTT                         PPDB MotifGCCCA  PLACE Motif 
 OsREG437            ACATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG517             CATGGGCC                PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474              ATGGGCCT               PPDB MotifGCCCA  PLACE Motif 
 OsREG430               TGGGCCTT              PPDB MotifGCCCA  PLACE Motif 
 OsREG497                GGGCCTTG             PPDB MotifGCCCA  PLACE Motif 
 OsREG467                        AGCCCATGGGCT PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525                         GCCCATGGGC  PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTCGTGGGCCTCATGGGCCGCA-4403240744032427-170-190
 OsREG601TCGTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC           PPDB MotifGCCCA  PLACE Motif 
 OsREG609         TCATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517          CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490           ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618            TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643             GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCT-4403244144032449-204-212
 OsREG422AAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTCGTGGGCCTCATGGGCCGCA-4403247544032495-238-258
 OsREG601TCGTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC           PPDB MotifGCCCA  PLACE Motif 
 OsREG609         TCATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517          CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490           ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618            TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643             GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGGCCCAGCCC-4403253444032542-297-305
 OsREG603GCCCAGCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG533 CCCAGCCC PPDB MotifGCCCA  PLACE Motif 
REGGGGAAAGC-4403256544032572-328-335
 OsREG621GGGAAAGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.