version
PlantPromoterDB promoter information of AK103164

Summary of Gene (AK103164)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0276700        NCBI 
Gene model AK103164  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 9701310-9700111)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK103164                         5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103164

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-9698773-213
TSS clone peakGclone-9698674-114

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCTCGCCCAACC-96987229698733-162-173
 OsREG549CCTCGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG595    GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGCACCGCACCGC-96987779698787-217-227
 OsREG500CACCGCAC    PPDB Motif  PLACE Motif 
 OsREG554   CGCACCGC PPDB Motif  PLACE Motif 
REGCCGTTGGA-96988009698807-240-247
 OsREG548CCGTTGGA PPDB MotifCCAACGG  PLACE Motif 
REGCCCGGCCCACAC-96988459698856-285-296
 OsREG538CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627   GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598    GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGGGGTGGGCCCCACCTGTCAGT-96988599698879-299-319
 OsREG600GGGTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC         PPDB Motif  PLACE Motif 
 OsREG612      GCCCCACC        PPDB Motif  PLACE Motif 
 OsREG514        CCCACCTG      PPDB MotifGCCCA  PLACE Motif 
 OsREG436         CCACCTGT     PPDB Motif  PLACE Motif 
 OsREG501          CACCTGTC    PPDB Motif  PLACE Motif 
 OsREG551            CCTGTCAG  PPDB Motif  PLACE MotifTGAC 
 OsREG453             CTGTCAGT PPDB Motif  PLACE MotifTGAC 
REGGCCCCCAC-96988899698896-329-336
 OsREG613GCCCCCAC PPDB Motif  PLACE Motif 
REGAACTGGGC-96989489698955-388-395
 OsREG425AACTGGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.