version
PlantPromoterDB promoter information of AK103212

Summary of Gene (AK103212)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0122300        NCBI 
Gene model AK103212  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 1158821-1160020)

Genome position     
from initiation codon
015-004-G08         
AK119295            
J033122M09          
J090007P13          
TSS from cDNA
TSS information
AK103212                         5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103212

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+1158845-976

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTTGGGCCCT+11586681158677-1153-1144
 OsREG581CTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG639 TTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475  TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGGCAGCCCATGGGCCTT+11587151158730-1106-1091
 OsREG591GCAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT        PPDB MotifGCCCA  PLACE Motif 
 OsREG467  AGCCCATG       PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525   GCCCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517      CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474       ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430        TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCTCTGTGGGCTTG+11587331158752-1088-1069
 OsREG581CTTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG471 TTGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG587  TGGGCCTC           PPDB MotifGCCCA  PLACE Motif 
 OsREG461          TGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG427           GTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG496            TGGGCTTG PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCGCA+11587721158783-1049-1038
 OsREG480ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643    GGGCCGCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.