version
PlantPromoterDB promoter information of AK103215

Summary of Gene (AK103215)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0244800        NCBI 
Gene model AK103215  
Description Similar to Alfin-1.  
#
#

Overview

Focused view (chromosome 11: 7786969-7785770)

Genome position     
from initiation codon
J065009E13          
J065027D16          
J065085B06          
J065180O17          
J090010C16          
J090039K20          
J090087A04          
TSS from cDNA
TSS information
AK103215                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103215

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-7786065-96

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCTCT-77860547786064-85-95
Y PatchCTCTCTCT-77860667786073-97-104
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTCTCCGC-77861697786176-200-207
 OsREG576CTCTCCGC PPDB Motif  PLACE Motif 
REGAGATGGGCCCT-77862127786222-243-253
 OsREG456AGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475   TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGGG-77862377786244-268-275
 OsREG538GGGCCGGG PPDB MotifGCCCA  PLACE Motif 
REGGCGACGCGACGCG-77863327786344-363-375
 OsREG559GCGACGCGACGCG PPDB Motif  PLACE MotifCGACG 
 OsREG583  GACGCGAC    PPDB Motif  PLACE Motif 
 OsREG556    CGCGACGC  PPDB Motif  PLACE MotifCGACG 
REGGTGGGCCCCACGTGTC-77863507786365-381-396
 OsREG640GTGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG647 TGGGCCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG641  GGGCCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC      PPDB Motif  PLACE Motif 
 OsREG572    GCCCCACG     PPDB Motif  PLACE Motif 
 OsREG450     CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG508      CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG434       CCACGTGT  PPDB MotifACGT  PLACE Motif 
 OsREG509        CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.