version
PlantPromoterDB promoter information of AK103282

Summary of Gene (AK103282)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0568300        NCBI 
Gene model AK103282  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 23025684-23024485)

Genome position     
from initiation codon
016-075-B02         
AK064398            
J033124M10          
J065120I21          
J065144H16          
TSS from cDNA
TSS information
AK103282                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103282

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-23024820-136

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGCCTATAAAA-2302485323024863-169-179
Y PatchTTCTCCTCCTCCTCC-2302479023024804-106-120
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGCTGGG-2302492223024930-238-246
 OsREG523TGGGCTGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG533 GGGCTGGG PPDB MotifGCCCA  PLACE Motif 
REGAGGGCCCATAC-2302495023024960-266-276
 OsREG475AGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG489 GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606   GCCCATAC PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGACCCAC-2302496823024979-284-295
 OsREG651GGTGGGAC     PPDB MotifGGGACCC  PLACE Motif 
 OsREG650 GTGGGACC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637   GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622    GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGCCACCTGTCAG-2302511023025120-426-436
 OsREG436CCACCTGT    PPDB Motif  PLACE Motif 
 OsREG501 CACCTGTC   PPDB Motif  PLACE Motif 
 OsREG551   CCTGTCAG PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.