version
PlantPromoterDB promoter information of AK103286

Summary of Gene (AK103286)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0132700        NCBI 
Gene model AK103286  
Description Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein.  
#
#

Overview

Focused view (chromosome 11: 1479137-1477938)

Genome position     
from initiation codon
J013088D06          
J033124M23          
J065117J18          
J065212D08          
J075054H05          
J075064B18          
J075116P12          
J075136K18          
J075179G09          
J090039M05          
J100023J01          
TSS from cDNA
TSS information
AK103286                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103286

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-1478206-69

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGTGGGCTTCCGGCCCAAAT-14782471478267-110-130
 OsREG597TTGTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG461 TGTGGGCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG427  GTGGGCTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG582   TGGGCTTC           PPDB MotifGCCCA  PLACE Motif 
 OsREG644         TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542          CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563           CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625            GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493             GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCAGTA-14782711478281-134-144
 OsREG658TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454  GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG604   GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGGA-14783061478313-169-176
 OsREG633GGCCCGGA PPDB Motif  PLACE Motif 
REGTTGTGGGCCTC-14783631478373-226-236
 OsREG597TTGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGGCCCAATA-14784391478446-302-309
 OsREG596GCCCAATA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.