version
PlantPromoterDB promoter information of AK103447

Summary of Gene (AK103447)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0434200        NCBI 
Gene model AK103447  
Description Zinc finger, RING-type domain containing protein.  
#
#

Overview

Focused view (chromosome 9: 16602398-16601199)

Genome position     
from initiation codon
AK062015            
J013039N06          
J023003L07          
J023113G21          
J023145A21          
J033129G15          
J100052N18          
J100055D22          
TSS from cDNA
TSS information
AK103447                         5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103447

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-16601628-230
TSS clone peakGclone-16601494-96

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCCTTCCTCCTCCC-1660146716601484-69-86
Y PatchTCCTCCCCT-1660163716601645-239-247
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACCCG-1660167616601683-278-285
 OsREG528CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCACAC-1660169816601708-300-310
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598   GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGGGACGGCCCAGTA-1660172016601732-322-334
 OsREG624GGACGGCC      PPDB Motif  PLACE Motif 
 OsREG584 GACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565   CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454    GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG604     GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGTC-1660173616601743-338-345
 OsREG584GGGCCGTC PPDB MotifGCCCA  PLACE Motif 
REGACTGGGCCTC-1660176716601776-369-378
 OsREG454ACTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG473 CTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587  TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGCACGTGGC-1660180016601807-402-409
 OsREG507CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGGGGCCCG-1660181916601826-421-428
 OsREG567GGGGCCCG PPDB MotifACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.