version
PlantPromoterDB promoter information of AK103474

Summary of Gene (AK103474)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0784400        NCBI 
Gene model AK103474  
Description Protein of unknown function DUF1692 domain containing protein.  
#
#

Overview

Focused view (chromosome 3: 33404863-33406062)

Genome position     
from initiation codon
J013088L01          
J023135I15          
J033130D12          
J043021G24          
J043035E20          
J065206K15          
J075053J20          
J075129B11          
J090003E22          
J090018F03          
J100023E23          
TSS from cDNA
TSS information
AK103474                         5'->3' (+)
Promoter sequence










 
Os03g0784300        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103474

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+33405265-598

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTC+3340523833405245-625-618
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGTCGCGTC+3340498733404996-876-867
 OsREG556GCGTCGCG   PPDB Motif  PLACE MotifCGACG 
 OsREG583  GTCGCGTC PPDB Motif  PLACE Motif 
REGTGGTGGGCTTT+3340504733405057-816-806
 OsREG599TGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG462 GGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG427  GTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCCAATT+3340507233405085-791-778
 OsREG422AAATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639    GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492     GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433      GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGCAAGCCCAATGGGCCGAGA+3340508733405105-776-758
 OsREG496CAAGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG460  AGCCCAAT          PPDB MotifGCCCA  PLACE Motif 
 OsREG431       AATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG490        ATGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658         TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG575          GGGCCGAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG635           GGCCGAGA PPDB Motif  PLACE Motif 
REGAAAAGCCCATCG+3340510733405118-756-745
 OsREG419AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466   AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG553    GCCCATCG PPDB MotifGCCCA  PLACE Motif 
REGCCGTCCGATC+3340514033405149-723-714
 OsREG545CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484 CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589  GTCCGATC PPDB Motif  PLACE Motif 
REGGGACGCGTGGG+3340518033405190-683-673
 OsREG442GGACGCGT    PPDB Motif  PLACE Motif 
 OsREG443  ACGCGTGG  PPDB Motif  PLACE Motif 
 OsREG530   CGCGTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.