version
PlantPromoterDB promoter information of AK103487

Summary of Gene (AK103487)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0615700        NCBI 
Gene model AK103487  
Description Proteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5).  
#
#

Overview

Focused view (chromosome 11: 25784790-25783591)

Genome position     
from initiation codon
AB026561            
AK059521            
J023078I20          
J033055A14          
J033055A16          
J033130M12          
J033140I23          
J033150P04          
J053046C12          
J053075E14          
J053079C09          
J065044A11          
J065050D21          
J065051N02          
J065052M02          
J065090I02          
J065101E07          
J065104I09          
J065116F15          
J065187J10          
J075024E07          
J075025O13          
J090013F15          
J090015I20          
J090062N12          
J090087G06          
J090089F24          
J090097N13          
J090098K11          
J100062D09          
TSS from cDNA
TSS information
AK103487                         5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103487

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-25785082-192
TSS clone peakGclone-25784978-88

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCCTCCTCTT-2578499225785003-102-113
Y PatchTCCCTCTC-2578505125785058-161-168
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAGGTGGGTCCC-2578508325785094-193-204
 OsREG514CAGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG622   GTGGGTCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG637    TGGGTCCC PPDB MotifGGGACCC  PLACE Motif 
REGCCATGGGCCTC-2578513325785143-243-253
 OsREG525CCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGACACGTGGGCCCGCA-2578515125785165-261-275
 OsREG434ACACGTGG        PPDB MotifACGT  PLACE Motif 
 OsREG508 CACGTGGG       PPDB MotifACGT  PLACE Motif 
 OsREG449  ACGTGGGC      PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571   CGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG566     TGGGCCCG   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG619      GGGCCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG632       GGCCCGCA PPDB Motif  PLACE Motif 
REGATTTGGGCCTT-2578517525785185-285-295
 OsREG493ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGTGGGGCCCACT-2578530225785312-412-422
 OsREG641TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647 GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478   GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGAACGGCCCG-2578537125785379-481-489
 OsREG423AACGGCCC  PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG446 ACGGCCCG PPDB MotifACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.