version
PlantPromoterDB promoter information of AK103667

Summary of Gene (AK103667)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0363700        NCBI 
Gene model AK103667  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 9: 12521187-12519988)

Genome position     
from initiation codon
J075001L14          
J075049M23          
J075051I04          
J075073L04          
J075077E03          
J075083J11          
J075094J22          
J075112E08          
J075137J23          
J075192E02          
J100039K04          
TSS from cDNA
TSS information
AK103667                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103667

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-12520975-788

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTCTCC-1252095112520961-764-774
Y PatchCCCTTCTCC-1252101112521019-824-832
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTTGGGCCGGCCCAAG-1252104012521056-853-869
 OsREG594TGTTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC         PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG615    GGGCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581         GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGATTGGGCTTTT-1252105812521068-871-881
 OsREG460ATTGGGCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 TTGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG421  TGGGCTTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG419   GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCCTC-1252108912521099-902-912
 OsREG437ACATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCTA-1252111712521127-930-940
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGGACAGGTGGG-1252113812521147-951-960
 OsREG501GACAGGTG   PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG  PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG PPDB MotifGCCCA  PLACE Motif 
REGGCCCATCC-1252115212521159-965-972
 OsREG608GCCCATCC PPDB MotifGCCCA  PLACE Motif 
REGTCCGTCCG-1252116612521173-979-986
 OsREG561TCCGTCCG PPDB Motif  PLACE Motif 
REGCTGACAGGTGGGCCCC-1252120312521218-1016-1031
 OsREG551CTGACAGG         PPDB Motif  PLACE MotifTGAC 
 OsREG501  GACAGGTG       PPDB Motif  PLACE Motif 
 OsREG436   ACAGGTGG      PPDB Motif  PLACE Motif 
 OsREG514    CAGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG476     AGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628      GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640       GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647        TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGGTCGCGCGC-1252125212521260-1065-1073
 OsREG557GTCGCGCG  PPDB MotifACGCGC  PLACE Motif 
 OsREG617 TCGCGCGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.