version
PlantPromoterDB promoter information of AK103678

Summary of Gene (AK103678)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0673100        NCBI 
Gene model AK103678  
Description Ribosomal protein S8E family protein.  
#
#

Overview

Focused view (chromosome 7: 29112304-29111105)

Genome position     
from initiation codon
006-032-D02         
006-073-A07         
009-116-G07         
011-064-C06         
AK060100            
AK104794            
J013038L23          
J033057I04          
J033068F02          
J033136C23          
J043034C02          
J065009G13          
J065038O21          
J065067D11          
J065173D21          
J065219M12          
TSS from cDNA
TSS information
AK103678                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103678

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-29111358-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTATAAATC-2911138429111393-80-89
Y PatchTCCTCCTCCCCC-2911134429111355-40-51
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCCCAAG-2911139829111407-94-103
 OsREG587GAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCT-2911141729111425-113-121
 OsREG609TCATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGGAGGCCCATAT-2911143129111441-127-137
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480   GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCAAG-2911145329111462-149-158
 OsREG421AAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG459  AGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACCT-2911148329111491-179-187
 OsREG462AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476 GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGCGCCACGTC-2911163729111645-333-341
 OsREG448CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.