version
PlantPromoterDB promoter information of AK103768

Summary of Gene (AK103768)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0191700        NCBI 
Gene model AK103768  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 4981090-4982289)

Genome position     
from initiation codon
AK066389            
J013110I03          
J033143I15          
J075065A01          
J100082M14          
TSS from cDNA
TSS information
AK103768                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK103768

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+4981980-110
TSS clone peakGclone+4982000-90

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCCTCCTCCCT+49819674981979-123-111
Y PatchTCCCCTCTCTCC+49819884981999-102-91
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAAGCCCATG+49818054981815-285-275
 OsREG519CCAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG496 CAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG467   AGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGGAGGCCCAGA+49818234981832-267-258
 OsREG587GAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCAGCCCAAG+49818404981854-250-236
 OsREG618GCGGCCCA        PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CGGCCCAG       PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG523     CCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG511      CAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG459       AGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCAAAGCCCAGTA+49818894981906-201-184
 OsREG656TAGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA         PPDB MotifGCCCA  PLACE Motif 
 OsREG421       AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG428        AAGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG604          GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGACCCGCGCGACGTGGGGCCCACGC+49819124981935-178-155
 OsREG439ACCCGCGC                 PPDB Motif  PLACE Motif 
 OsREG557   CGCGCGAC              PPDB MotifACGCGC  PLACE Motif 
 OsREG450         ACGTGGGG        PPDB MotifACGT  PLACE Motif 
 OsREG572          CGTGGGGC       PPDB Motif  PLACE Motif 
 OsREG631           GTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641            TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647             GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640              GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571               GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG602                GCCCACGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.