version
PlantPromoterDB promoter information of AK104320

Summary of Gene (AK104320)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0810100        NCBI 
Gene model AK104320  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 36173740-36172541)

Genome position     
from initiation codon
AK071916            
AK099056            
TSS from cDNA
TSS information
AK104320                         5'->3' (-)
Promoter sequence









 
AK069286            
J023010J12          
J065047I12          
J090020D03          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK104320

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-36172835-95

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTC-3617279536172802-55-62
Y PatchTCTTCCTCTT-3617280536172814-65-74
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTTGGGCCACACG-3617290536172917-165-177
 OsREG626GTTGGGCC      PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG659 TTGGGCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG653  TGGGCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG573     GCCACACG PPDB Motif  PLACE Motif 
REGATGGCCCAGCCCAATT-3617293136172946-191-206
 OsREG487ATGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523     CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511      CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG460       AGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433        GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGGTTGGTGG-3617297936172986-239-246
 OsREG520GTTGGTGG PPDB MotifCCAACGG  PLACE Motif 
REGTGGATGGGTGGGC-3617305636173068-316-328
 OsREG534TGGATGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG600     GGGTGGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.