version
PlantPromoterDB promoter information of AK104323

Summary of Gene (AK104323)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0592800        NCBI 
Gene model AK104323  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 29624176-29622977)

Genome position     
from initiation codon
012-072-B04         
015-072-G07         
AK067627            
AK070388            
TSS from cDNA
TSS information
AK104323                         5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK104323

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-29623599-423
TSS clone peakAclone-29623595-419
TSS cloneAclone-29623556-380

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCCCTCTCCTCCCC-2962355729623576-381-400
Y PatchTCCTCCTCTT-2962360429623613-428-437
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAACGGCCCAGA-2962367429623685-498-509
 OsREG494CAACGGCC     PPDB MotifCCAACGG  PLACE Motif 
 OsREG423 AACGGCCC    PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445  ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565   CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629    GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGCGCGTCGCCACGTGTCCACGCC-2962370729623728-531-552
 OsREG559CGCGTCGC               PPDB Motif  PLACE MotifCGACG 
 OsREG448     CGCCACGT          PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507      GCCACGTG         PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434       CCACGTGT        PPDB MotifACGT  PLACE Motif 
 OsREG509        CACGTGTC       PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451         ACGTGTCC      PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG636              TCCACGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.