version
PlantPromoterDB promoter information of AK104393

Summary of Gene (AK104393)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0219900        NCBI 
Gene model AK104393  
Description Similar to Epstein-Barr nuclear antigen-1 (EBNA-1).  
#
#

Overview

Focused view (chromosome 2: 6712910-6711711)

Genome position     
from initiation codon
004-018-E11         
006-055-D07         
AK060915            
AK099194            
AK104206            
J013072C21          
J013151J19          
J023109D07          
J023138K01          
J065093B06          
J080017E11          
J090031J05          
TSS from cDNA
TSS information
AK104393                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK104393

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-6712027-117
TSS clone peakAclone-6711999-89

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCCTC-67119756711985-65-75
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTGGGCCCCACCCCCCACAC-67121256712146-215-236
 OsREG547CCGTGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC          PPDB Motif  PLACE Motif 
 OsREG612      GCCCCACC         PPDB Motif  PLACE Motif 
 OsREG438           ACCCCCCA    PPDB Motif  PLACE Motif 
 OsREG535              CCCCACAC PPDB Motif  PLACE Motif 
REGTCGCGCGC-67121616712168-251-258
 OsREG617TCGCGCGC PPDB Motif  PLACE Motif 
REGATCGGACGGCCCACGT-67121946712209-284-299
 OsREG484ATCGGACG         PPDB Motif  PLACE Motif 
 OsREG545 TCGGACGG        PPDB Motif  PLACE Motif 
 OsREG562  CGGACGGC       PPDB Motif  PLACE Motif 
 OsREG624   GGACGGCC      PPDB Motif  PLACE Motif 
 OsREG584    GACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445     ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564      CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571       GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449        GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
REGCCGATCCGATCCG-67122216712233-311-323
 OsREG541CCGATCCGATCCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.