version
PlantPromoterDB promoter information of AK104412

Summary of Gene (AK104412)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0797600        NCBI 
Gene model AK104412  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 34082907-34084106)

Genome position     
from initiation codon
006-034-B06         
009-066-A01         
014-035-H08         
AK067446            
AK068388            
TSS from cDNA
TSS information
AK104412                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK104412

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+34083801-106

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCTCC+3408378434083793-123-114
Y PatchCTCTCCTC+3408384234083849-65-58
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATATGGGCCTT+3408351934083529-388-378
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGGT+3408354334083550-364-357
 OsREG441GGCCCGGT PPDB Motif  PLACE Motif 
REGTAGGCCCATCA+3408365234083662-255-245
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGGGCCGAAA+3408366934083676-238-231
 OsREG634GGCCGAAA PPDB Motif  PLACE Motif 
REGGGACGGCCCACGTACAGCCCATCAAGGCCCATAT+3408370134083734-206-173
 OsREG624GGACGGCC                           PPDB Motif  PLACE Motif 
 OsREG584 GACGGCCC                          PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA                         PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564   CGGCCCAC                        PPDB MotifGCCCA  PLACE Motif 
 OsREG571    GGCCCACG                       PPDB MotifGCCCA  PLACE Motif 
 OsREG449     GCCCACGT                      PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG435             ACAGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG491              CAGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG466               AGCCCATC            PPDB MotifGCCCA  PLACE Motif 
 OsREG607                GCCCATCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG497                      CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430                       AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474                        AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630                         GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480                          GCCCATAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.